Your browser lacks required capabilities. Please upgrade it or switch to another to continue.
Loading…
,,,,<span class="bigtext">You are correct!</span>
There were 9,724 new cases reported in China in January of 2020.
By January 31, 2020 there were 11 confirmed cases of COVID-19 in the U.S. There was one other country with reported cases in January on the data table, what was the other country?
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" allowfullscreen="true" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2F66EuRermmcfWpMBxdWmH%2Ffile.json"></iframe>
What was the other country with data by January 31, 2020? (choose one)
[[China|1]]
[[Italy|2]]
[[United States of America|3]]
[[Restart Game|start]]<span class="bigtext">Determine how fast viruses can spread around the world.</span>
Once scientists identified the new COVID-19 virus in late 2019, scientists and doctors started reporting when and where it appeared around the world.
On December 31, 2019 the Wuhan Municipal Health Commission in China reported a cluster of pneumonia cases, which were later identified as the new coronavirus, or COVID-19. The virus was spreading quickly. How many new cases were reported in China in January of 2020?
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" allowfullscreen="true" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2F66EuRermmcfWpMBxdWmH%2Ffile.json"></iframe>
How many new cases were reported in China in January of 2020?
It was [[69,669 cases|next1]].
It was [[44 cases|next3]].
It was [[9,724 cases|next]].
It was [[11 cases|next2]].<span class="bigtext">Data Escape Room: Flatten the Curve</span>
The year is 2050 and a brand-new virus has appeared and is spreading around the globe. Scientists have observed that the new virus appears to be very similar to COVID-19. You are a scientist on the president’s virus task force, you have been asked to examine COVID-19 data from 2020 to help predict how quickly the new virus might spread and help make the vaccine.
You have 3 tasks:
1. Determine how fast viruses can spread around the world.
2. Identify places where outbreaks happened in the COVID-19 pandemic.
3. Determine which people are the most at risk.
Are you ready to learn about data and solve the puzzle of this new virus?
To make it through this virtual escape room, break the code, and develop a vaccine [[start here|start]].
<img src="images/NGSS.png" /><span class="bigtext">5 months is incorrect ...</span>
The United States of America was well over 100,000 cases by month five.
<img src="images/DogCat.png" />
In the Cats and Dogs Dataset above, the first row, or line across from left to right, is a listing of variables for the dataset. Each variable is at the top of a COLUMN. For example "Cats" is a variable at the top of the COLUMN for information about cats.
<B>HINT:</B> In the data table for <U>Global COVID-19 Cases</U> look for the COLUMN "United States of America" and follow it down until you reach a number that is close to 100,000. After you find that number count how many months passed since January (with January equaling zero months).
<img src="images/COVID.png" />
[[Try again!|2]]
[[Restart Game|start]]<span class="bigtext">3 months is incorrect ...</span>
The United States of America was well over 100,000 cases by month three. If you were thinking of it being the third month, March, and picked three because of that then you're very close! Read the hint below to help you even further.
<img src="images/COVID.png" />
<B>HINT:</B> In the data table for <U>Global COVID-19 Cases</U> look for the COLUMN "United States of America" and follow it down until you reach a number that is close to 100,000. After you find that number count how many months passed since January (with January equaling zero months).
[[Try again!|2]]
[[Restart Game|start]]<span class="bigtext">You are correct!!</span>
<<set $happiness to 0>>
Two months after January was March. In March 2020 there were 140,574 cases of COVID-19 in the United States of America. This was over 100,000 cases in total. In this data table there is one country that never reported more than 600 cases. Fewer cases shows better management of the spread of the COVID-19 virus. Which country in the data table never reported more than 600 cases in a single month?
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" allowfullscreen="true" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2F66EuRermmcfWpMBxdWmH%2Ffile.json"></iframe>
Which country in the data table never reported more than 600 cases in a single month and was most successful at preventing the spread of the coronavirus (COVID-19)?
Place your answer in the blank below in all capital letters.
(Example: COUNTRY)
<<textbox "$name" "">>
When you're ready, click [[here|A]].
[[Restart Game|start]]<span class="bigtext">4 months is incorrect ...</span>
The United States of America was well over 100,000 cases by month four.
<img src="images/DogCat.png" />
In the Cats and Dogs Dataset above, the first row, or line across from left to right, is a listing of variables for the dataset. Each variable is at the top of a COLUMN. For example "Cats" is a variable at the top of the COLUMN for information about cats.
<B>HINT:</B> In the data table for <U>Global COVID-19 Cases</U> look for the COLUMN "United States of America" and follow it down until you reach a number that is close to 100,000. After you find that number count how many months passed since January (with January equaling zero months).
<img src="images/COVID.png" />
[[Try again!|2]]
[[Restart Game|start]]<span class="bigtext">1 month is incorrect ...</span>
The United States of America had recorded only 55 cases in one month.
<img src="images/DogCat.png" />
In the Cats and Dogs Dataset above, the first row, or line across from left to right, is a listing of variables for the dataset. Each variable is at the top of a COLUMN. For example "Cats" is a variable at the top of the COLUMN for information about cats.
<B>HINT:</B> In the data table for <U>Global COVID-19 Cases</U> look for the COLUMN "United States of America" and follow it down until you reach a number that is close to 100,000. After you find that number count how many months passed since January (with January equaling zero months).
<img src="images/COVID.png" />
[[Try again!|2]]
[[Restart Game|start]]<<cacheaudio "mainsong" "music/Forgiven.mp3">>
<<cacheaudio "secondsong" "music/Come.mp3">>
<<cacheaudio "desertsong" "music/Desert.mp3">><<if $name is "NEW ZEALAND">><span class="bigtext">You're Correct!!
New Zealand had less than 600 cases per month.</span>
<<set $happiness to $happiness + 1>>
Now that you've studied the outbreak let's learn about the cure, or vaccine. The first COVID-19 vaccines were made using a new technology and are called mRNA vaccines. mRNA is similar to DNA, it is a string of molecules inside your cells that contains a code with instructions for how to build proteins. Scientists represent these molecules that make up mRNA with the letters U, C, G, and A. The order of these molecules in the mRNA provides the instructions your body needs to make proteins.
Start at the center of the maze and end at the country that was most successful in preventing the spread of COVID-19. The letters you pass on the way are the code to the mRNA vaccine for the new disease.
<img src="images/Task1.jpg" />
Place your answer in the blank below in all capital letters (HINT: your answer should have eight letters).
(Example: AAAAAAAA)
<<textbox "$name" "">>
Click [[here|B]] to continue!
<<else>><span class="bigtext">Try again!</span>
<<set $happiness to $happiness - 1>>
<img src="images/DogCat.png" />
In the Cats and Dogs Dataset above, the first row, or line across from left to right, is a listing of variables for the dataset. The variables for this data table are Fur Type, Cats, Dogs, and Average. These variables are at the top of each COLUMN.
<B>HINT:</B> In the data table for <U>Global COVID-19 Cases</U> look for the COLUMN that has numbers that are all less than 1,000 in it. Follow that column to the top for the variable or name of the country. Type in the country's name in all capital letters - put a space between words if it has more than one word in its name and <U>don't</U> put a space after the name.
<img src="images/COVID.png" />
Return to [[try again|NM]].
<</if>>
[[Restart Game|start]]<<if $name is "ACGCCAUG">><span class="bigtext">You're Correct!!</span>
<img src="images/mRNA.gif" />
<img src="images/mRNAT1.png" />
Meet Anika Chebrolu, an 8th grader from Frisco, Texas. Her scientific work in a national middle school science competition is helping to find a cure for COVID-19. You can read more about her below.
<img src="images/WoSci1.png" />
[[Let's Continue!|B2]]
<<else>><span class="bigtext">Try again!</span>
<<set $happiness to $happiness - 1>>
<B>Here's a Helpful HINT:</B> You know that New Zealand is the country that never reported more than 600 cases of COVID-19. Follow the maze from start with your finger on the screen to get to New Zealand as the exit. Write down every letter you pass as you pass them. Type in the letters (in order) in all capital letters - <U>don't</U> put a space after or between the letters.
<img src="images/Task1.jpg" />
Return to [[try again|A2]].
<</if>>
[[Restart Game|start]]<span class="bigtext">You are correct!</span>
<<set $happiness to $happiness + 1>>
New Mexico had the highest number of cases on November 24, 2020.
While New Mexico implemented strong measures to contain the virus for almost a year, Arizona and Texas stopped the strong measures after a few months.
Drag these 2 states (AZ and TX) from the data table onto the graph to determine if these states had more cases than New Mexico on November 24, 2020.
<img src="images/t2s2.gif" />
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" allowfullscreen="true" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2FeumKBxyyxvIg8N8cqZ5U%2Ffile.json"></iframe>
Which of the three states had the most cases? (choose one)
[[New Mexico|F]]
[[Texas|G]]
[[Arizona|H]]
[[Restart Game|start]]<span class="bigtext">Incorrect ...</span>
<<set $happiness to $happiness - 1>>
February 23, 2021 was not the date when New Mexico had the highest number of cases. Here is a video to help you so that you can try again.
<iframe width="560" height="315" src="https://www.youtube.com/embed/zQNq2lv28D4" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture" allowfullscreen></iframe>
[[Try again!|B2]]
[[Restart Game|start]]<span class="bigtext">Incorrect ...</span>
<<set $happiness to $happiness - 1>>
December 1, 2020 was not the date when New Mexico had the highest number of cases. Here is a video to help you so that you can try again.
<iframe width="560" height="315" src="https://www.youtube.com/embed/zQNq2lv28D4" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture" allowfullscreen></iframe>
[[Try again!|B2]].
[[Restart Game|start]]<span class="bigtext">Not quite ...</span>
<<set $happiness to $happiness - 1>>
Arizona did not have the most on November 24, 2020 when compared to New Mexico and Texas. Watch this video for help and then try again.
<iframe width="560" height="315" src="https://www.youtube.com/embed/q7EM-sbZMjA" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture" allowfullscreen></iframe>
I'm ready to [[try again|C]].
[[Restart Game|start]]<span class="bigtext">Not quite ...</span>
<<set $happiness to $happiness - 1>>
New Mexico did not have the most on November 24, 2020 when compared to Arizona and Texas. Watch this video for help and then try again.
<iframe width="560" height="315" src="https://www.youtube.com/embed/q7EM-sbZMjA" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture" allowfullscreen></iframe>
I'm ready to [[try again|C]].
[[Restart Game|start]]<span class="bigtext">You are correct!</span>
Texas had the most cases on November 24, 2020 when compared to Arizona and New Mexico.
Next determine which state saw the fastest increase in cases. To do this add connecting lines between the points on the graph.
<img src="images/t2s3.gif" />
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" allowfullscreen="true" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2FVcE0vI0LBWxv7tUqyGoX%2Ffile.json"></iframe>
Which state’s cases increased the most during December of 2020? Enter your answer in all capital letters. (Example: STATE)
<<textbox "$name" "">>
When you're ready, click [[here|I]].
[[Restart Game|start]]<<if $name is "CALIFORNIA">><span class="bigtext">You're Correct!!</span>
<<set $happiness to $happiness + 1>>
California's cases increased the most during December of 2020.
Remove California from the graph.
<img src="images/t2s4.gif" />
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" allowfullscreen="true" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2FttwCSBmGxDJCasTVtR8y%2Ffile.json"></iframe>
COVID-19 cases went up in many places during the winter, partly because people traveled to visit family for Thanksgiving and Christmas. Texas, Florida, New York, and Arizona all had their <B>highest</B> number of cases in January 2021. What holiday was this 2 weeks after?
<img src="images/Dec2020.png" />
Approximately 2 weeks after which holiday did Texas, Florida, New York, and Arizona see the most cases? Input your answer below in a date format of MM/DD/YYY. (Example: 01/01/2001)
<<textbox "$name" "">>
When you're ready, click [[here|M]].
<<else>><span class="bigtext">Try again!</span>
<<set $happiness to $happiness - 1>>
Here is a video to help you with this task.
<iframe width="560" height="315" src="https://www.youtube.com/embed/_AJic0MtiZc" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture" allowfullscreen></iframe>
<B>HINT:</B> Type in the state's name in all capital letters - put a space between words if it has more than one word in its name and <U>don't</U> put a space after the name.
Return to [[try again|G2]].
<</if>>
[[Restart Game|start]]<span class="bigtext">69,669 is incorrect ...</span>
Though there were 69,669 cases in China, that was in February 2020.
<B>Watch the video for reading a data table.</B>
<iframe width="560" height="315" src="https://www.youtube.com/embed/dVTR5sho9tk" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture" allowfullscreen></iframe>
(Then check your answer [[here|here1]].)
<B>HINT:</B> In the data table for <U>Global COVID-19 Cases</U> look for the ROW of January 2020 and the COLUMN of China.
<img src="images/COVID.png" />
[[Try again!|start]]<span class="bigtext">11 is incorrect ... </span>
The number 11 does show up in the data table, but it is not data about China in January 2020.
<B>Watch the video for reading a data table.</B>
<iframe width="560" height="315" src="https://www.youtube.com/embed/dVTR5sho9tk" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture" allowfullscreen></iframe>
(Then check your answer [[here|here1]].)
<B>HINT:</B> In the data table for <U>Global COVID-19 Cases</U> look for the ROW of January 2020 and the COLUMN of China.
<img src="images/COVID.png" />
[[Try again!|start]]<span class="bigtext">44 is incorrect ...</span>
Though there were 44 cases in China, that was in December 2019.
<B>Watch the video for reading a data table.</B>
<iframe width="560" height="315" src="https://www.youtube.com/embed/dVTR5sho9tk" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture" allowfullscreen></iframe>
(Then check your answer [[here|here1]].)
<B>HINT:</B> In the data table for <U>Global COVID-19 Cases</U> look for the ROW of January 2020 and the COLUMN of China.
<img src="images/COVID.png" />
[[Try again!|start]]<span class="bigtext">China is incorrect ...</span>
Even though China did have 9,724 cases in January 2020 they already had cases before that. We're looking for a <U>new</U> country that had cases in January 2020 along with the United States (U.S.).
<img src="images/DogCat.png" />
In the Cats and Dogs Dataset above, the first row, or line across from left to right, is a listing of variables for the dataset. Underneath that row there are titles for information listed in the data table.
<B>HINT:</B> In the data table for <U>Global COVID-19 Cases</U> look for the ROW of January 2020 and then make sure that the variable headers are <U>not</U> China or the United States of America.
<img src="images/COVID.png" />
[[Try again!|next]]<span class="bigtext">You are correct!</span>
When the U.S. had 11 cases, Italy also had <B>three</B> confirmed cases by January 31, 2020.
The first confirmed cases of COVID-19 were reported in the U.S. on January 20, 2020. How many months did it take to reach more than 100,000 cases?
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" allowfullscreen="true" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2F66EuRermmcfWpMBxdWmH%2Ffile.json"></iframe>
How many months did it take for the U.S. to reach more than 100,000 cases of COVID-19? (choose one)
[[1 month|OK]]
[[2 months|NM]]
[[3 months|AZ]]
[[4 months|TX]]
[[5 months|CA]]
[[Restart Game|start]]
<span class="bigtext">United States of America is incorrect ...</span>
The United States of America is the U.S. and they had 11 cases in January 2020. We're looking for another <U>new</U> country that had cases in January 2020 along with the United States.
<img src="images/DogCat.png" />
In the Cats and Dogs Dataset above, the first row, or line across from left to right, is a listing of variables for the dataset. Underneath that row there are titles for information listed in the data table.
<B>HINT:</B> In the data table for <U>Global COVID-19 Cases</U> look for the ROW of January 2020 and then make sure that the variable headers are <U>not</U> China or the United States of America.
<img src="images/COVID.png" />
[[Try again!|next]]<<if $name is "12/31/2020">><span class="bigtext">You're Correct!!</span>
<<set $happiness to $happiness + 1>>
<img src="images/2020.gif" />
Approximately 2 weeks after New Years Eve – 12/31/2020 - is when Texas, Florida, New York, and Arizona saw the most cases.
Click here to [[continue|N]].
<<else>><span class="bigtext">Try again!</span>
<<set $happiness to $happiness - 1>>
Here is a video to help you with this task.
<iframe width="560" height="315" src="https://www.youtube.com/embed/p8vY4AtAgvA" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture" allowfullscreen></iframe>
<B>HINT:</B> When entering the date make sure that there are not any spaces between the numbers or before or after your answer.
Return to [[try again|I2]].
<</if>>
[[Restart Game|start]]<span class="bigtext">Second mRNA</span>
<<set $happiness to $happiness + 1>>
Use the cipher to determine the code for the next piece of mRNA, your clue is New Year’s Eve. Watch the bottom of the screen to get your mRNA code.
<img src="images/Cipher.gif" />
Place your answer in the blank below in all capital letters (HINT: your answer should have eight letters).
(Example: AAAAAAAA)
<<textbox "$name" "">>
When you're ready, click [[here|O]].
[[Restart Game|start]]<<if $name is "AGACUCUG">><span class="bigtext">You're Correct!!</span>
<<set $happiness to $happiness + 1>>
As a scientist you can use past data to identify places where outbreaks happened in the COVID-19 pandemic in order to predict new outbreaks.
<img src="images/mRNAT2.png" />
Meet Dr. Katalin Kariko whose work with mRNA played a huge role in developing the COVID-19 vaccines. You can read more about her below.
<img src="images/WoSci2.png" />
You have completed the second task and have determineed where outbreaks happened in order to slow the spread of the new virus.
In this last part you need to determine which people are the most at risk.
Click [[here|P]] to continue!
<<else>><span class="bigtext">Try again!</span>
<<set $happiness to $happiness - 1>>
You didn't enter the mRNA quite right. Here's a hint to find the mRNA.
<img src="images/Cipher2.gif" />
<B>HINT:</B> Type in the letters (in order as listed above) in all capital letters - <U>don't</U> put a space after or between the letters.
Return to [[try again|N]].
<</if>>
[[Restart Game|start]]<span class="bigtext">Determine which people are the most at risk.</span>
<<set $happiness to $happiness + 1>>
The virus seems to be more dangerous for some people, depending on that person’s age, race, and medical history. Answer the questions about which age groups were most at risk of getting sick or dying from COVID-19.
Graph the number of cases by age group. Drag Age Group to the X-axis, and Cases to the Y-axis.
<img src="images/t3s1.gif" />
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" allowfullscreen="true" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2FkkAz1dFBliM5fWgfBdxS%2Ffile.json"></iframe>
Which age group had the most cases of COVID-19? Input your answer below as an age range (Example: 0-10)
<<textbox "$name" "">>
When you're ready, click [[here|Q]].
[[Restart Game|start]]<<if $name is "18-29">><span class="bigtext">You're Correct!!</span>
<<set $happiness to $happiness + 1>>
People in the age range of 18-29 had the most cases of COVID-19.
Graph the number of deaths by age group. Were they also the age group most likely to die from the virus?
<img src="images/t3s2.gif" />
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" allowfullscreen="true" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2F8clq7nlUEhwC7GdZfJXq%2Ffile.json"></iframe>
Did the 18–29-year-old age group also have the most deaths?
Answer "YES" or "NO" below in all capital letters.
<<textbox "$name" "">>
When you're ready, click [[here|R]].
<<else>><span class="bigtext">Try again!</span>
<<set $happiness to $happiness - 1>>
Here is a video to help you with this task.
<iframe width="560" height="315" src="https://www.youtube.com/embed/_j9w3sHJ8YQ" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture" allowfullscreen></iframe>
<B>HINT:</B> Type in the numbers with a dash in the middle <U>don't</U> put a space after or between the numbers.
Return to [[try again|P]].
<</if>>
[[Restart Game|start]]<<if $name is "NO">><span class="bigtext">You're Correct!!</span>
<<set $happiness to $happiness + 1>>
The 18–29-year-old age group did <B>not</B> have the most deaths along with having the most cases.
Rearrange the bars from highest to lowest number of cases. (Hint: you can rearrange the bars on the graph by dragging the labels on the X-axis.)
<img src="images/t3s3-1.gif" />
Then drag the mRNA code letter onto the middle of the graph to color code the bars.
<img src="images/t3s3-2.gif" />
This graph will give you the last piece of mRNA code you need to make the vaccine.
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" allowfullscreen="true" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2FjU0OoiLRXycQAQVwCvyC%2Ffile.json"></iframe>
What is the last strand of mRNA? <B>HINT:</B> Use only the first eight letters for your strand of mRNA.
Place your answer in the blank below in all capital letters. (Example: AAAAAAAA)
<<textbox "$name" "">>
When you're ready, click [[here|S]].
<<else>><span class="bigtext">Try again!</span>
<<set $happiness to $happiness - 1>>
Here is a video to help you with this task.
<iframe width="560" height="315" src="https://www.youtube.com/embed/4dIYbThPMKk" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture" allowfullscreen></iframe>
<B>HINT:</B> This is a question to answer with "YES" or "NO" in the box. Do not place any spaces before or after your answer.
(instructions on how to find the most at risk ethnicity)
Return to [[try again|Q2]].
<</if>>
[[Restart Game|start]]<<if $name is "CUCAGGAA">><span class="bigtext">You're Correct!!</span>
<<set $happiness to $happiness + 1>>
CUCAGGAA is the last strand you need for your mRNA.
Vaccines teach your immune system to recognize and fight a virus, often by giving you a piece of the virus. Your immune system learns to recognize the piece, so that it is ready to fight it, when it encounters the actual virus.
The first 2 vaccines developed to fight COVID-19 introduce your immune system to the spike protein on the outside of the virus.
As you’ve been gathering information on how to fight the virus, you’ve been collecting all sorts of information. Use the answers to the questions below to break the code, which will tell you the right combination of molecules to create a spike protein. Crack the code to make the vaccine.
A.) How many digits are in the age 20, from the age group that had the most cases of COVID-19?
B.) How many strands of mRNA did you collect to make this vaccine?
C.) What number do you multiply 8 by to get 8 as the answer?
Your mRNA strands:
1. ACGCCAUG
2. AGACUCUG
3. CUCAGGAA
Input your answer in the box below. Use the numbers from your questions (A, B, and C) to determine the order that your strands will go into the box. Your final mRNA code will have 27 letters in all capitals.
(Example: AAAAAAAAAAAAAAAAAAAAAAAAAAA)
<<textbox "$name" "">>
When you're ready, click [[here|T]].
<<else>><span class="bigtext">Try again!</span>
<<set $happiness to $happiness - 1>>
Here is a video to help you with this task.
<iframe width="560" height="315" src="https://www.youtube.com/embed/_Brgyhcy0sU" title="YouTube video player" frameborder="0" allow="accelerometer; autoplay; clipboard-write; encrypted-media; gyroscope; picture-in-picture" allowfullscreen></iframe>
Return to [[try again|R2]].
<</if>>
[[Restart Game|start]]<<if $name is "AGACUCUGCUCAGGAAACGCCAUG">><span class="bigtext">You are correct!</span>
Researchers have been studying and working with mRNA vaccines for decades. Interest has grown in these vaccines because they can be developed in a laboratory using readily available materials. This means vaccine development can be faster than traditional methods of making vaccines. mRNA vaccines take advantage of the process that cells use to make proteins in order to trigger an immune response and build immunity to COVID-19. In contrast, most vaccines use weakened versions of the disease to stimulate the body’s immune response and build immunity.
mRNA vaccines have been studied before for flu, Zika, and rabies. Future mRNA vaccine technology may allow for one vaccine to provide protection for multiple common vaccine-preventable diseases.
Scientists like Dr. Kizzmekia Corbett took the necessary information about the virus that causes COVID-19 to assist in designing the mRNA vaccine.
<img src="images/WoSci3.png" />
What brand of vaccine did she help with? Input your answer below in all capital letters. (Example: ANSWER)
<<textbox "$name" "">>
When you're ready, click [[here|U]].
<<else>><span class="bigtext">No, $name is not the correct mRNA sequence.</span>
Remember to place all of the letters in order, no spaces, in all capital letters.
<B>HINT:</B> The order is 2, 3, 1 for your mRNA strands.
[[Try again|S2]]<</if>>
[[Restart Game|start]]<<if $name is "MODERNA">><span class="bigtext">CORRECT! You've used data to complete this escape room!</span>
<img src="images/Vaccine.gif" />
You've cracked the code to make the vaccine. Great job!
[[Restart Game|StoryTitle]]
<<else>><span class="bigtext">No, $name is not the correct brand.</span>
Dr. Corbett helped to develop and produce the mRNA-based <U>Moderna</U> COVID-19 vaccine.
<B>HINT:</B> The underlined word is the brand. Put that into the box in all capital letters without any spaces.
Return to [[try again|T2]].
[[Restart Game|start]]<</if>>The box that lines up with both headers has a number that will answer this question: 2.
Go back to the [[previous page|next2]]The box that lines up with both headers has a number that will answer this question: 2.
Go back to the [[previous page|next3]]The box that lines up with both headers has a number that will answer this question: 2.
Go back to the [[previous page|next1]]<span class="bigtext">You're Correct!!
New Zealand had less than 600 cases per month.</span>
<<set $happiness to $happiness + 1>>
Now that you've studied the outbreak let's learn about the cure, or vaccine. The first COVID-19 vaccines were made using a new technology and are called mRNA vaccines. mRNA is similar to DNA, it is a string of molecules inside your cells that contains a code with instructions for how to build proteins. Scientists represent these molecules that make up mRNA with the letters U, C, G, and A. The order of these molecules in the mRNA provides the instructions your body needs to make proteins.
Start at the center of the maze and end at the country that was most successful in preventing the spread of COVID-19. The letters you pass on the way are the code to the mRNA vaccine for the new disease.
<img src="images/Task1.jpg" />
Place your answer in the blank below in all capital letters (HINT: your answer should have eight letters).
(Example: AAAAAAAA)
<<textbox "$name" "">>
Click [[here|B]] to continue!
[[Restart Game|start]]<span class="bigtext">Let's now identify places where outbreaks happened in the COVID-19 pandemic!</span>
<<set $happiness to $happiness + 1>>
When the virus first started to appear in the U.S., it did not spread across the entire country at once, each state took different actions to try and slow the spread of the virus, some states were more successful than others. Use the data to determine where outbreaks happened.
When COVID-19 began to quickly spread around the country in March 2020, many states immediately took steps to try and slow the spread of the virus by closing schools, restaurants, and offices, requiring people to wear masks in public, and implementing stay at home orders.
New Mexico implemented several strong containment measures and continued them for months.
Graph the number of cases in New Mexico by dragging NM from the data table, onto the Y-axis of the graph.
<img src="images/t2s1.gif" />
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2Ff5AGHI0nvwymHP39SWC9%2Ffile.json"></iframe>
What date shows the highest number of cases in New Mexico? (choose one)
[[November 24, 2020|C]]
[[February 23, 2021|D]]
[[December 1, 2020|E]]
[[Restart Game|start]]<span class="bigtext">You are correct!</span>
Texas had the most cases on November 24, 2020 when compared to Arizona and New Mexico.
Next determine which state saw the fastest increase in cases. To do this add connecting lines between the points on the graph.
<img src="images/t2s3.gif" />
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" allowfullscreen="true" webkitallowfullscreen="true" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2FVcE0vI0LBWxv7tUqyGoX%2Ffile.json"></iframe>
Which state’s cases increased the most during December of 2020? Enter your answer in all capital letters. (Example: STATE)
<<textbox "$name" "">>
When you're ready, click [[here|I]].
[[Restart Game|start]]<span class="bigtext">You're Correct!!</span>
<<set $happiness to $happiness + 1>>
California's cases increased the most during December of 2020.
Remove California from the graph.
<img src="images/t2s4.gif" />
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" allowfullscreen="true" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2FttwCSBmGxDJCasTVtR8y%2Ffile.json"></iframe>
COVID-19 cases went up in many places during the winter, partly because people traveled to visit family for Thanksgiving and Christmas. Texas, Florida, New York, and Arizona all had their <B>highest</B> number of cases in January 2021. What holiday was this 2 weeks after?
<img src="images/Dec2020.png" />
Approximately 2 weeks after which holiday did Texas, Florida, New York, and Arizona see the most cases? Input your answer below in a date format of MM/DD/YYY. (Example: 01/01/2001)
<<textbox "$name" "">>
When you're ready, click [[here|M]].
[[Restart game|start]]<span class="bigtext">You're Correct!!</span>
<<set $happiness to $happiness + 1>>
People in the age range of 18-29 had the most cases of COVID-19.
Graph the number of deaths by age group. Were they also the age group most likely to die from the virus?
<img src="images/t3s2.gif" />
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" allowfullscreen="true" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2F8clq7nlUEhwC7GdZfJXq%2Ffile.json"></iframe>
Did the 18–29-year-old age group also have the most deaths?
Answer "YES" or "NO" below in all capital letters.
<<textbox "$name" "">>
When you're ready, click [[here|R]].
[[Restart game|start]]<span class="bigtext">You're Correct!!</span>
<<set $happiness to $happiness + 1>>
The 18–29-year-old age group did <B>not</B> have the most deaths along with having the most cases.
Rearrange the bars from highest to lowest number of cases. (Hint: you can rearrange the bars on the graph by dragging the labels on the X-axis.)
(Insert GIF 1 of 2)
Then drag the mRNA code letter onto the middle of the graph to color code the bars.
(Insert GIF 2 of 2)
This graph will give you the last piece of mRNA code you need to make the vaccine.
<iframe width="1200px" height="900px" frameborder="no" scrolling="no" allowfullscreen="true" webkitallowfullscreen="true" mozallowfullscreen="true" src="https://codap.concord.org/app/static/dg/en/cert/index.html#shared=https%3A%2F%2Fcfm-shared.concord.org%2FjU0OoiLRXycQAQVwCvyC%2Ffile.json"></iframe>
What is the last strand of mRNA? <B>HINT:</B> Use only the first eight letters for your strand of mRNA.
Place your answer in the blank below in all capital letters. (Example: AAAAAAAA)
<<textbox "$name" "">>
When you're ready, click [[here|S]].
[[Restart game|start]]<span class="bigtext">You're Correct!!</span>
<<set $happiness to $happiness + 1>>
CUCAGGAA is the last strand you need for your mRNA.
Vaccines teach your immune system to recognize and fight a virus, often by giving you a piece of the virus. Your immune system learns to recognize the piece, so that it is ready to fight it, when it encounters the actual virus.
The first 2 vaccines developed to fight COVID-19 introduce your immune system to the spike protein on the outside of the virus.
As you’ve been gathering information on how to fight the virus, you’ve been collecting all sorts of information. Use the answers to the questions below to break the code, which will tell you the right combination of molecules to create a spike protein. Crack the code to make the vaccine.
A.) How many digits are in the age 20, from the age group that had the most cases of COVID-19?
B.) How many strands of mRNA did you collect to make this vaccine?
C.) What number do you multiply 8 by to get 8 as the answer?
Your mRNA strands:
1. ACGCCAUG
2. AGACUCUG
3. CUCAGGAA
Input your answer in the box below. Use the numbers from your questions (A, B, and C) to determine the order that your strands will go into the box. Your final mRNA code will have 27 letters in all capitals.
(Example: AAAAAAAAAAAAAAAAAAAAAAAAAAA)
<<textbox "$name" "">>
When you're ready, click [[here|T]].
[[Restart game|start]]<span class="bigtext">You are correct!</span>
Researchers have been studying and working with mRNA vaccines for decades. Interest has grown in these vaccines because they can be developed in a laboratory using readily available materials. This means vaccine development can be faster than traditional methods of making vaccines. mRNA vaccines take advantage of the process that cells use to make proteins in order to trigger an immune response and build immunity to COVID-19. In contrast, most vaccines use weakened versions of the disease to stimulate the body’s immune response and build immunity.
mRNA vaccines have been studied before for flu, Zika, and rabies. Future mRNA vaccine technology may allow for one vaccine to provide protection for multiple common vaccine-preventable diseases.
Scientists like Dr. Kizzmekia Corbett took the necessary information about the virus that causes COVID-19 to assist in designing the mRNA vaccine.
<img src="images/WoSci3.png" />
What brand of vaccine did she help with? Input your answer below in all capital letters. (Example: ANSWER)
<<textbox "$name" "">>
When you're ready, click [[here|U]].
[[Restart game|start]]